Advances in diagnosis and treatment of myocardial damage in childern DMD/BMD / 国际儿科学杂志

Duchenne/Becker muscular dystrophy(DMD/BMD)is a progressive, destructive neuromuscular disease.It is caused by mutations in the gene encoding dystrophy.The mutations come in various forms and the severity of the disease varies.The onset of the disease is insidious, and the initial manifestation is only abnormal serum enzymes.With the progression of the disease, the skeletal muscle and myocardial striated muscle cells are further destroyed, gait abnormalities and myocardial damage gradually appear, and eventually most children die of heart failure.At present, there is no effective radical cure.The existing treatment methods, including oral glucocorticoids and restoring functional dystrophin, are mostly limited to alleviate skeletal muscle symptoms, and are very limited to improve cardiac symptoms.This article reviews the progress in the diagnosis and treatment of myocardial damage in DMD/BMD, in order to provide reference for clinical research and gene therapy.

Analysis of two Chinese Han families with Duchenne/Becker muscular dystrophy / 上海交通大学学报（医学版）

Objective: To deepen the understanding of Duchenne/Becker muscular dystrophy by investigating dystrophin (DMD) gene variants in 2 Chinese Han families with this disease. Methods: Retrospective analysis of the clinical characteristics of the probands in two families with Duchnne/ Becker muscular dystrophy and the results of multiplex ligation-dependent probe amplification (MLPA) for the probands and their relatives was performed. Results: Three probands were identified by significantly-elevated creatine kinase levels. Two probands in family one are fraternal twin brothers with the same deletions of exons 8-9, while their mother has no abnormality at this site. The proband in family two is the little brother in a pair of fraternal twins with duplication of exons 48-51, and his mother has heterozygous duplication of exons 48-51. Conclusion: ① The presence of the same DMD gene mutation in the fraternal twins suggests that the mother may be a gonad chimera with this mutation if her gene detection of peripheral blood is normal. The mother must undergo prenatal gene diagnosis to reduce the risk of Duchenne/Becker muscular dystrophy in her offsprings. ② The exons 48-51 duplication of DMD gene is pathogenic mutation.

Clinical analysis of Duchenne/ Becker muscular dystrophy with transaminase elevation as the initial presenta-tion / 中华实用儿科临床杂志

Objective To analyze the clinical characteristics of Duchenne/ Becker muscular dystrophy (DMD/BMD)with the initial presentation of transaminase elevation,in order to improve the clinician's understanding of this disease,and reduce misdiagnosis and missed diagnosis. To investigate the relationship between the elevation of transami-nase and the early stage of DMD/ BMD,and to provide the strategy for early diagnosis. Methods Twenty - four pa-tients admitted to the hospital with elevated serum transaminase as the initial presentation from January 2012 to Decem-ber 2014,who were diagnosed as DMD/ BMD by genetic testing or muscle biopsy,were enrolled. Their clinical data and laboratory examinations were retrospectively analyzed,including clinical features,diagnostic steps,serum muscle en-zymes,genetic analysis,electromyography and muscle pathological changes. Results The 24 patients were all male without family history of DMD/ BMD prior to birth. The average visiting age was (3. 4 ± 1. 2)years (ranging from 0. 8 to 6. 1 years),and 87. 5％ (21 / 24 cases)of cases were preschool children aged 2 - 6 years. Hypertransaminasemia was found in 21 cases (87. 5％)during the kindergarten physical examination,1 case during pre - operative investigation and 2 cases during respiratory infection. Due to its insidious onset,the time interval between incidental finding of elevated transaminase and definitive diagnosis was between 0. 6 and 20. 4 months. Among them,16 cases (66. 7％)had obvious pseudohypertrophy of calf muscles,and 18 cases (81. 8％)showed different degrees of movement disorder,such as unable to jump,easy to fall,and difficulty in climbing stairs. In addition,18. 2％ cases (4 / 22 cases)had a delay in language development. The serum alanine aminotransferase and aspartate aminotransferase levels were 120. 3 - 761. 7 U/ L and 83. 3 - 675. 5 U/ L,respectively. Serum creatine kinase (CK)was found to be markedly elevated (ranging from 3940 to 27510 U/ L)in all patients. Electromyography showed myogenic damage in 13 / 23 cases (56. 5％). DMD gene deletions were found in 18 cases (75. 0％),and duplications in 4 cases (16. 7％). The muscle biopsy performed in 2 cases (8. 3％)multiplex ligation - dependent probe amplification (MLPA)- negative cases showed evidence of dystrophic features on routine histology. Immunohistochemistry showed absent dystrophin staining in all 2 MLPA - nega-tive cases. Conclusion The clinical manifestation of DMD/ BMD is not typical in the early stage,so it is easy to be neglected or misdiagnosed. Elevated ALT and AST are important clues in the early diagnosis of DMD/ BMD. Children with elevated transaminase,in the absence of other signs and symptoms of hepatic injury,may have occult muscular di-sease,most frequently DMD/ BMD. A thorough physical examination and history taking as well as the measurement of serum CK are helpful in the differential diagnosis. Genetic testing or muscle biopsy should be done early for correct diagnosis of DMD/ BMD.

Genetic Analysis of Dystrophin Gene for Affected Male and Female Carriers with Duchenne/Becker Muscular Dystrophy in Korea

Duchenne and Becker muscular dystrophy (DMD/BMD) are X-linked recessive disorders caused by mutation in dystrophin gene. We analyzed the results of a genetic test in 29 DMD/BMD patients, their six female relatives, and two myopathic female patients in Korea. As the methods developed, we applied different procedures for dystrophin gene analysis; initially, multiplex polymerase chain reaction was used, followed by multiplex ligation-dependent probe amplification (MLPA). Additionally, we used direct DNA sequencing for some patients who had negative results using the above methods. The overall mutation detection rate was 72.4% (21/29) in DMD/BMD patients, identifying deletions in 58.6% (17/29). Most of the deletions were confined to the central hot spot region between exons 44 and 55 (52.9%, 7/19). The percentage of deletions and duplications revealed by MLPA was 45.5% (5/11) and 27.2% (3/11), respectively. Using the MLPA method, we detected mutations confirming their carrier status in all female relatives and symptomatic female patients. In one patient in whom MLPA revealed a single exon deletion of the dystrophin gene, subsequent DNA sequencing analysis identified a novel nonsense mutation (c.4558G > T; Gln1520X). The MLPA assay is a useful quantitative method for detecting mutation in asymptomatic or symptomatic carriers as well as DMD/BMD patients.

Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative / 中华神经科杂志

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Clinical Usefulness of Molecular Diagnosis in Dystrophin Gene Mutations Using the Multiplex Ligation-dependent Probe Amplification (MLPA) Method

BACKGROUND: Duchenne/Becker muscular dystrophy (DMD/BMD), which is the most common X-linked muscular dystrophy, is caused by mutations in the dystrophin gene. These mutations comprise deletions in approximately 55~65% of patients, duplications in 5~10%, and point mutations or small insertion/deletions in the remainder. Unfortunately, current diagnostic assays for dystrophin do not accurately detect duplication mutations or female carriers. In this study we employed multiplex ligation-dependent probe amplification (MLPA) analysis to detect deletions or duplications of the dystrophin gene in patients with DMD/BMD, and in potential female carriers. METHODS: A total of 41 subjects was recruited for this study, comprising 35 male DMD/BMD patients, 1 female patient with Turner syndrome, and 5 females with a family history of DMD/BMD. The MLPA method was employed to determine the copy number of each of the 79 exons of the dystrophin gene in the 41 subjects. RESULTS: MLPA analysis for dystrophin was informative in 71.4% (25/35) of patients with DMD/BMD patients, identifying deletions in 60.0% (21/35) and duplications in 11.4% (4/35). MLPA analysis showed the presence of a deletion of the DMD gene in one female patient with Turner syndrome. Of the five female patients with a family history of DMD/BMD, this assay revealed exon deletion in one and duplications in one. CONCLUSIONS: The reported findings reveal that the MLPA method is a powerful tool for detecting duplications and female carriers, as well as DMD gene deletions. MLPA should be considered the method of choice for an initial genetic analysis of DMD/BMD patients.

Diagnostic testing for Duchenne/Becker Muscular dystrophy using Dual Priming Oligonucleotide (DPO) system

PURPOSE: Large exon deletions in the DMD gene are found in about 60% of DMD/BMD patients. Multiplex PCR has been employed to detect the deletion mutation, which frequently generates noise PCR products due to the presence of multiple primers in a single reaction as well as the stringency of PCR conditions. This often leads to a false-negative or false-positive result. To address this problematic issue, we introduced the dual primer oligonucleotide (DPO) system. DPO contains two separate priming regions joined by a polydeoxyinosine linker that results in high PCR specificity even under suboptimal PCR conditions. METHODS: We tested 50 healthy male controls, 50 patients with deletion mutation as deletion-positive patient controls, and 20 patients with no deletions as deletion-negative patient controls using DPO- multiplex PCR. Both the presence and extent of deletion were verified by simplex PCR spanning the promoter region (PM) and 18 exons including exons 3, 4, 6, 8, 12, 13, 17, 19, 43-48, 50-52, and 60 in all 120 controls. RESULTS: DPO-multiplex PCR showed 100% sensitivity and specificity for the detection a deletion. However, it showed 97.1% sensitivity and 100% specificity for determining the extent of deletions. CONCLUSION: The DPO-multiplex PCR method is a useful molecular test to detect large deletions of DMD for the diagnosis of patients with DMD/BMD because it is easy to perform, fast, and cost-effective and has excellent sensitivity and specificity.

Molecular Genetic Analysis of Dystrophin Gene in Duchenne/Becker Muscular Dystrophy

PURPOSE: Duchenne/Becker muscular dystrophy(DMD/BMD) is an X-linked recessive disorder caused by mutations of dystrophin genes. The purpose of the present study is to determine the frequency and the patterns of dystrophin gene deletions and to investigate the correlation of genotypes and phenotypes. METHODS: There were included a total of 89 children(88 boys and 1 girl) diagnosed as DMD/BMD by immunohistochemistry and/or genetic analysis from 1999 to 2003 at Seoul National University Children's Hospital. We analyzed the genomic DNA by multiplex PCR using a 26 dystrophin exon primer set. Direct sequencing was performed on 23 exons(in which point mutations were detected in other previous reports) in 22 patients without deletions. Phenotype and genotype relationship analysis was performed on the basis of retrospective clinical reviews. RESULTS: The frequency of dysmorphin gene deletions was 54%(32/59), which is lower than that of European and American data. Exon deletions were detected in 59 cases and the deletion "hot spots" were exon 44-54 constituting 80% of all deletions. In 6 cases without detectable deletions, 6 point mutaions(3 nonsense mutations and 3 nucleotide variants) were detected. The patients whose deletions were in the central parts or the patients with multiple exon deletions tended to show earlier symptom onsets and more rapid progressions of weakness but there were no statistical significances. CONCLUSION: Since deletions in dystrophin genes were detected in about 50% of the patients, studies on dystrophin protein expressions using muscle biopsy samples must be done for correct diagnosis.

Molecular Genetic Analysis of Dystrophin Gene in Duchenne/Becker Muscular Dystrophy

PURPOSE: Duchenne/Becker muscular dystrophy(DMD/BMD) is an X-linked recessive disorder caused by mutations of dystrophin genes. The purpose of the present study is to determine the frequency and the patterns of dystrophin gene deletions and to investigate the correlation of genotypes and phenotypes. METHODS: There were included a total of 89 children(88 boys and 1 girl) diagnosed as DMD/BMD by immunohistochemistry and/or genetic analysis from 1999 to 2003 at Seoul National University Children's Hospital. We analyzed the genomic DNA by multiplex PCR using a 26 dystrophin exon primer set. Direct sequencing was performed on 23 exons(in which point mutations were detected in other previous reports) in 22 patients without deletions. Phenotype and genotype relationship analysis was performed on the basis of retrospective clinical reviews. RESULTS: The frequency of dysmorphin gene deletions was 54%(32/59), which is lower than that of European and American data. Exon deletions were detected in 59 cases and the deletion "hot spots" were exon 44-54 constituting 80% of all deletions. In 6 cases without detectable deletions, 6 point mutaions(3 nonsense mutations and 3 nucleotide variants) were detected. The patients whose deletions were in the central parts or the patients with multiple exon deletions tended to show earlier symptom onsets and more rapid progressions of weakness but there were no statistical significances. CONCLUSION: Since deletions in dystrophin genes were detected in about 50% of the patients, studies on dystrophin protein expressions using muscle biopsy samples must be done for correct diagnosis.